The masked chromosome

A tale of grand theft genome and the mysterious origins of the Y chromosome ... I was looking at the sequence of the Y chromosome and trundling merrily along: TTGGAGTGGAATGGAATAGAGAGGAACGAATTGGAATGGAGGGTAGTGGAATGGAGTGGATTCCAGTGGA GTGGAGTGGATTGGATTGGAATGGAATGGAATAGATTGGATTGGAGTGGTGCAGAGTGGAATTCNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Whaaa? Did someone fall asleep at the wheel? Did the government shutdown in the middle of sequencing the Y chromosome? You know …

Advertisements