Kaushik Ghose

All your genome are belong to us

CFFI-ize!

Ok, so it doesn’t have as nice a ring to it as “Cythonize!” but the Python C-Foreign Function Interface blew my mind away. I had previously used Cython to write … Continue reading

October 25, 2014 · Leave a comment

maximum [1..1e6]

I had heard about Haskell – the coolest language on the block – from several friends. After reading the chapter on typeclasses from Learn You A Haskell for Great Good my … Continue reading

September 26, 2014 · Leave a comment

The year humans lost a pair of chromosomes

Many mistakes in science persist because the creators of wrong knowledge refuse to acknowledge their mistakes and often intimidate others (with correct information) from positions of power. This phenomenon has lead a once well known practitioner of the trade to remark “Science advances one funeral at a time”.

August 20, 2014 · Leave a comment

Cythonize!

In this post I take Python code to do a task (draw fractals), write it in the spirit of Python (a pleasure to write, read and maintain), use profiling to … Continue reading

July 28, 2014 · Leave a comment

A note on “The Worst Programming Interview Question”

Rod Hilton has a blog post where he argues against using puzzler type questions during an interview. I agree with him in spirit, but feel that puzzler questions have a … Continue reading

July 13, 2014 · 2 Comments

The masked chromosome

A tale of grand theft genome and the mysterious origins of the Y chromosome … I was looking at the sequence of the Y chromosome and trundling merrily along: TTGGAGTGGAATGGAATAGAGAGGAACGAATTGGAATGGAGGGTAGTGGAATGGAGTGGATTCCAGTGGA … Continue reading

June 16, 2014 · Leave a comment

The engineer’s disease

Knobs are fun. I turn on the gizmo, twiddle the knobs and see what happens. What is not fun, is if I turn on the gizmo, and it just sits there and does … Continue reading

May 10, 2014 · 2 Comments
Follow

Get every new post delivered to your Inbox.

Join 33 other followers